pPRIME-CMV-GFP-FF3
(Plasmid #11663)

• Purpose: 3rd generation lentiviral transfer vector. pPRIME cloning plasmid with CMV promoter controlling expression of GFP and miR30-based shRNA targeting firefly luciferase
• Depositing Lab: Stephen Elledge
• Publication: Stegmeier et al Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13212-7.

Backbone

• Vector backbone: pPRIME-CMV-GFP
• Backbone size w/o insert (bp): 8509
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: FF3
• Alt name: firefly luciferase hairpin
• Species: Firefly
• Insert Size (bp): 120
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: EGFP-C

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.

Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC).

Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.