pPRIME-TET-GFP-FF3
(Plasmid #11662)

• Purpose: 3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferase
• Depositing Lab: Stephen Elledge
• Publication: Stegmeier et al Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13212-7.

Backbone

• Vector backbone: pPRIME-TET-GFP
• Backbone size w/o insert (bp): 8226
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: FF3
• Alt name: firefly luciferase hairpin
• Species: Firefly
• Insert Size (bp): 120
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: EGFP-C

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.

Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)