pLVUTHshGATA1-tTR-KRAB
(Plasmid #11650)

• Depositing Labs: Patrick Aebischer, Didier Trono
• Publication: Szulc et al Nat Methods. 2006 Feb . 3(2):109-16.

Backbone

• Vector backbone: pLVUT-tTR-KRAB
• Backbone size w/o insert (bp): 11876
• Vector type: Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on
• Alt name: shRNA against GATA1
• Alt name: GATCCCCGAAGCGCCTGATTGTCAGTTTCAAGAGAACTGACAATCAGGCGCTTCTTTTTGGAAA
• Alt name: GATA1
• Species: H. sapiens (human)
• Entrez Gene: GATA1 (a.k.a. ERYF1, GATA-1, GF-1, GF1, HAEADA, NF-E1, NFE1, XLANP, XLTDA, XLTT)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: See map

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transgenes can be expressed from any RNA Pol II promoter as part of
bicistronic unit comprising the KRAB-based repressor; tetO sequences
are inserted into the vector LTR. Tet-on and Tet-off versions rely on
repressors that bind in the absence or the presence of doxycycline,
respectively. Addition of Pol III promoter-small hairpin RNA cassette
allows for drug-controllable RNA interference (Tet-on shRNA).

Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked
questions on cloning strategies and packaging.
You may also visit LentiWeb http://www.lentiweb.com for discussion on cloning strategies and protocols.