Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLHCX-ATF4 mScarlet NLS
(Plasmid #115970)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115970 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLHCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6813
  • Total vector size (bp) 7991
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    activating transcription factor 4
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1178
  • Entrez Gene
    ATF4 (a.k.a. CREB-2, CREB2, TAXREB67, TXREB)
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA tag (N terminal on insert)
    • mScarlet-I (C terminal on insert)
    • c-myc NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This sensor leads to the expression of a mScarlet-I fusion protein in the nucleus upon induction of ER-stress. ER-stress kinetic through the PERK/ATF4 pathway can thus be monitored by recording the red fluorescent signal arising in the nucleus.
Designed by Adrien Nougarède.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLHCX-ATF4 mScarlet NLS was a gift from David Andrews (Addgene plasmid # 115970 ; http://n2t.net/addgene:115970 ; RRID:Addgene_115970)
  • For your References section:

    Improved IRE1 and PERK Pathway Sensors for Multiplex Endoplasmic Reticulum Stress Assay Reveal Stress Response to Nuclear Dyes Used for Image Segmentation. Nougarede A, Tesniere C, Ylanko J, Rimokh R, Gillet G, Andrews DW. Assay Drug Dev Technol. 2018 Aug 8. doi: 10.1089/adt.2018.862. 10.1089/adt.2018.862 PubMed 30088945