pLVX-ATF4 mScarlet NLS
(Plasmid #115969)

• Purpose: ER-stress sensor - ATF4 translation at ORF3 fluorescent reporter with mScarlet-I
• Depositing Lab: David Andrews
• Publication: Nougarede et al Assay Drug Dev Technol. 2018 Aug 8. doi: 10.1089/adt.2018.862.

Backbone

• Vector backbone: pLVX-Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8102
• Total vector size (bp): 9268
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: activating transcription factor 4
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1166
• Entrez Gene: ATF4 (a.k.a. CREB-2, CREB2, TAXREB67, TXREB)
• Promoter: CMV
• Tags / Fusion Proteins:
  • HA tag (N terminal on insert)
  • mScarlet-I (C terminal on insert)
  • c-myc NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: CAGCGGGGCTGCTAAAGCGCATGC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This sensor leads to the expression of a mScarlet-I fusion protein in the nucleus upon induction of ER-stress. ER-stress kinetic through the PERK/ATF4 pathway can thus be monitored by recording the red fluorescent signal arising in the nucleus.
Designed by Adrien Nougarède.