pLVX-XBP1 mNeonGreen NLS
(Plasmid #115968)

• Purpose: ER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreen
• Depositing Lab: David Andrews
• Publication: Nougarede et al Assay Drug Dev Technol. 2018 Aug 8. doi: 10.1089/adt.2018.862.

Backbone

• Vector backbone: pLVX-Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8102
• Total vector size (bp): 9163
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: X-box binding protein 1
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1061
• Entrez Gene: XBP1 (a.k.a. TREB-5, TREB5, XBP-1, XBP2)
• Promoter: CMV
• Tags / Fusion Proteins:
  • HA tag (N terminal on insert)
  • mNeonGreen (C terminal on insert)
  • c-myc NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: CAGCGGGGCTGCTAAAGCGCATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This sensor leads to the expression of a mNeonGreen fusion protein in the nucleus upon induction of ER-stress. ER-stress kinetic through the IRE1/XBP1 pathway can thus be monitored by recording the green fluorescent signal arising in the nucleus.
Designed by Adrien Nougarède.