pcDNA 3.3 LRP5
(Plasmid #115907)

• Purpose: Expresses human LRP5 in mammalian cells.
• Depositing Lab: Harald Junge
• Publication: Lai et al Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004.

Backbone

• Vector backbone: pcDNA3.3 TOPO TA
• Backbone size w/o insert (bp): 5407
• Total vector size (bp): 10260
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LRP5
• Species: H. sapiens (human)
• Insert Size (bp): 4853
• Entrez Gene: LRP5 (a.k.a. BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP-7, LRP7, OPPG, OPS, OPTA1, PCLD4, VBCH2)
• Promoter: CMV

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CTTCCGTGTTTCAGTTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Image clone 9056965
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry