pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
(Plasmid
#115890)
-
PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a 1.1
-
Backbone manufactureroriginal from Scott Sternson's lab
- Backbone size w/o insert (bp) 4974
- Total vector size (bp) 6579
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArchon1-KGC-GFP-ER2
-
SpeciesSynthetic
-
Insert Size (bp)1605
-
GenBank IDMG250280.1
- Promoter EF1a(1.1kb short version)
-
Tags
/ Fusion Proteins
- KGC (C terminal on insert)
- GFP (C terminal on insert)
- ER2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggatcttggttcattctcaag
- 3′ sequencing primer aaagagacagcaaccagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2 was a gift from Edward Boyden (Addgene plasmid # 115890 ; http://n2t.net/addgene:115890 ; RRID:Addgene_115890) -
For your References section:
A robotic multidimensional directed evolution approach applied to fluorescent voltage reporters. Piatkevich KD, Jung EE, Straub C, Linghu C, Park D, Suk HJ, Hochbaum DR, Goodwin D, Pnevmatikakis E, Pak N, Kawashima T, Yang CT, Rhoades JL, Shemesh O, Asano S, Yoon YG, Freifeld L, Saulnier JL, Riegler C, Engert F, Hughes T, Drobizhev M, Szabo B, Ahrens MB, Flavell SW, Sabatini BL, Boyden ES. Nat Chem Biol. 2018 Feb 26. pii: 10.1038/s41589-018-0004-9. doi: 10.1038/s41589-018-0004-9. 10.1038/s41589-018-0004-9 PubMed 29483642