pAPM-D4- miR30-L1221
(Plasmid
#115846)
-
PurposeControl shRNA KD vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAPM-D4-mir30
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecontrol shRNA
-
gRNA/shRNA sequenceCTTGTCGATGAGAGCGTTTGT
-
SpeciesH. sapiens (human)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PuroR . Please visit https://www.biorxiv.org/content/early/2018/04/03/293001 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAPM-D4- miR30-L1221 was a gift from Jeremy Luban (Addgene plasmid # 115846 ; http://n2t.net/addgene:115846 ; RRID:Addgene_115846) -
For your References section:
Primate immunodeficiency virus proteins Vpx and Vpr counteract transcriptional repression of proviruses by the HUSH complex. Yurkovetskiy L, Guney MH, Kim K, Goh SL, McCauley S, Dauphin A, Diehl WE, Luban J. Nat Microbiol. 2018 Dec;3(12):1354-1361. doi: 10.1038/s41564-018-0256-x. Epub 2018 Oct 8. 10.1038/s41564-018-0256-x PubMed 30297740