pCMV-SpdCas9-VP64
(Plasmid #115794)

• Purpose: Expresses SpdCas9-Vp64 fusion protein when packaged into AAV
• Depositing Lab: Nadav Ahituv
• Publication: Matharu et al Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629.

Backbone

• Vector backbone: pAAV-Ef1a-FAS-EGFP-WPRE-pA
• Backbone size w/o insert (bp): 3899
• Total vector size (bp): 8855
• Vector type: Mammalian Expression, AAV
• Selectable markers: NONE

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VP64
• Species: S.pyogenes
• Insert Size (bp): 4452
• Promoter: CMV
• Tags / Fusion Proteins:
  • dCas9-VP64 (C terminal on insert)
  • 3XFLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CATAACTTACGGTAAATGGCCCGC
• 3′ sequencing primer: GCCATAGAGCCCACCGCATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid: 47107
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry