-
PurposeAn AAV vector expressing S. aureus dCas9 fused to VP64.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-NLS-dSaCas9-NLS-VPR
- Backbone size w/o insert (bp) 3462
- Total vector size (bp) 7194
-
Modifications to backboneRemoved RelA(p65) AND Rta AD domains from fusion
-
Vector typeMammalian Expression, AAV
-
Selectable markersNONE
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSa-dCas9
-
Alt namenuclease deactivated SauCas9
-
Alt namedSaCas9
-
SpeciesS. aureus
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS-VP64 (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCGTAACAACTCCGCCCCATTGA
- 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid: 68495
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-sadCas9-VP64 was a gift from Nadav Ahituv (Addgene plasmid # 115790 ; http://n2t.net/addgene:115790 ; RRID:Addgene_115790) -
For your References section:
CRISPR-mediated activation of a promoter or enhancer rescues obesity caused by haploinsufficiency. Matharu N, Rattanasopha S, Tamura S, Maliskova L, Wang Y, Bernard A, Hardin A, Eckalbar WL, Vaisse C, Ahituv N. Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629. 10.1126/science.aau0629 PubMed 30545847