-
PurposeAn AAV vector expressing S. aureus dCas9 fused to VP64.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-NLS-dSaCas9-NLS-VPR
- Backbone size w/o insert (bp) 3462
- Total vector size (bp) 7194
-
Modifications to backboneRemoved RelA(p65) AND Rta AD domains from fusion
-
Vector typeMammalian Expression, AAV
-
Selectable markersNONE
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSa-dCas9
-
Alt namenuclease deactivated SauCas9
-
Alt namedSaCas9
-
SpeciesS. aureus
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS-VP64 (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCGTAACAACTCCGCCCCATTGA
- 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid: 68495
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-sadCas9-VP64 was a gift from Nadav Ahituv (Addgene plasmid # 115790 ; http://n2t.net/addgene:115790 ; RRID:Addgene_115790) -
For your References section:
CRISPR-mediated activation of a promoter or enhancer rescues obesity caused by haploinsufficiency. Matharu N, Rattanasopha S, Tamura S, Maliskova L, Wang Y, Bernard A, Hardin A, Eckalbar WL, Vaisse C, Ahituv N. Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629. 10.1126/science.aau0629 PubMed 30545847