pCMV-sadCas9-VP64
(Plasmid #115790)

• Purpose: An AAV vector expressing S. aureus dCas9 fused to VP64.
• Depositing Lab: Nadav Ahituv
• Publication: Matharu et al Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-NLS-dSaCas9-NLS-VPR
• Backbone size w/o insert (bp): 3462
• Total vector size (bp): 7194
• Modifications to backbone: Removed RelA(p65) AND Rta AD domains from fusion
• Vector type: Mammalian Expression, AAV
• Selectable markers: NONE

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sa-dCas9
• Alt name: nuclease deactivated SauCas9
• Alt name: dSaCas9
• Species: S. aureus
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS-VP64 (C terminal on insert)
  • NLS (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCGTAACAACTCCGCCCCATTGA
• 3′ sequencing primer: CAACAGATGGCTGGCAACTAGAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid: 68495

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry