pcDNA3.3 ss-3xFLAG-hLRP5 (aa 32-1615)
(Plasmid #115788)

• Purpose: Expresses human LRP5 with N-terminal 3xflag tag in mammalian cells, contains artificial signal sequence upstream of tag.
• Depositing Lab: Harald Junge
• Publication: Lai et al Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004.

Backbone

• Vector backbone: pcDNA3.3 TOPO TA
• Backbone size w/o insert (bp): 5373
• Total vector size (bp): 10318
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LRP5
• Species: H. sapiens (human)
• Insert Size (bp): 4945
• Mutation: contains silent mutation that creates an internal EcoRI restriction site in the c-terminal region
• Entrez Gene: LRP5 (a.k.a. BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP-7, LRP7, OPPG, OPS, OPTA1, PCLD4, VBCH2)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xflag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CTTCCGTGTTTCAGTTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Image clone 9056965
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry