p426MET25_SSKar2-sfpHluorin-HDEL (ER-sfpHluorin, MRV66)
(Plasmid #115698)

• Purpose: ER-targeted superfolder pHluorin for improved pH measurements in the ER of S. cerevisiae
• Depositing Lab: Eckhard Boles
• Publication: Reifenrath et al Sci Rep. 2018 Aug 10;8(1):11985. doi: 10.1038/s41598-018-30367-z.

Backbone

• Vector backbone: p246MET25
• Backbone size w/o insert (bp): 6271
• Total vector size (bp): 7129
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SSKar2-sfpHluorin-HDEL
• Alt name: ER-sfpHluorin
• Alt name: ER-targeted superfolder pHluorin
• Species: Aequorea victoria
• Insert Size (bp): 858
• Mutation: for introduced mutations see publication
• GenBank ID: M62653.1
• Promoter: MET25
• Tags / Fusion Proteins:
  • ER signal sequence of Kar2 (N terminal on insert)
  • ER retention signal containing HDEL (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GCGTCTGTTAGAAAGGAAGTTTTTCC
• 3′ sequencing primer: ACCTAGACTTCAGGTTGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry