pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
(Plasmid #115694)

• Purpose: All-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.
• Depositing Lab: Erik Sontheimer
• Publication: Amrani et al Genome Biol. 2018 Dec 5;19(1):214. doi: 10.1186/s13059-018-1591-1.

Backbone

• Vector backbone: pSimpleII
• Backbone size w/o insert (bp): 5693
• Total vector size (bp): 8936
• Modifications to backbone: None
• Vector type: Mammalian Expression, Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: NmeCas9
• Species: Neisseria meningitidis, strain 8013
• Insert Size (bp): 3243
• Mutation: None
• GenBank ID: FM999788.1 19818133
• Promoter: EF-1 alpha
• Tags / Fusion Proteins:
  • NLS, HA (C terminal on insert)
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gctgccttcaaacctaattcaatcaactacatcctc
• 3′ sequencing primer: acggacaggcgggcgttttttca

Gene/Insert 2

• Gene/Insert name: Nme-sgRNA
• Species: Neisseria meningitidis, strain 8013
• Insert Size (bp): 156
• Mutation: fusion of repeat/tracrRNA to make a sgRNA
• GenBank ID: FM999788.1
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagcagatactggcttaactatg
• 3′ sequencing primer: aaataaacaaataggggttccgc

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry