pKEW336-MBP-TEV-MbCas12a-33362
(Plasmid
#115670)
-
PurposeExpresses MbCas12 (from M. bovoculi 33362) in bacteria via T7 RNAP, for purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbone2CT
-
Backbone manufacturerUC Berkeley
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 9756
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMbCas12a
-
Alt nameMbCpf1
-
SpeciesMoraxella bovoculi
-
Insert Size (bp)3786
-
GenBank IDWP_046695838.1
- Promoter T7 RNAP
-
Tag
/ Fusion Protein
- MBP-TEV (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAGACTAATTCGAGCTCGAAC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKEW336-MBP-TEV-MbCas12a-33362 was a gift from Jennifer Doudna (Addgene plasmid # 115670 ; http://n2t.net/addgene:115670 ; RRID:Addgene_115670) -
For your References section:
Systematic discovery of natural CRISPR-Cas12a inhibitors. Watters KE, Fellmann C, Bai HB, Ren SM, Doudna JA. Science. 2018 Oct 12;362(6411):236-239. doi: 10.1126/science.aau5138. Epub 2018 Sep 6. 10.1126/science.aau5138 PubMed 30190307