Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTSSX-STC
(Plasmid #115668)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTSSX
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    small tetraheme cytochrome c
  • Alt name
    STC
  • Alt name
    CctA
  • Species
    Shewanella oneidensis MR-1
  • Insert Size (bp)
    393
  • GenBank ID
    NP_718311
  • Promoter tac
  • Tag / Fusion Protein
    • Signal peptide (aa1-27)-Strep-II tag- Factor Xa cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTCTGGCAAATATTCTGAAATGAG
  • 3′ sequencing primer CAAATGCCTGAGGTTTCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSSX-STC was a gift from David Kramer (Addgene plasmid # 115668 ; http://n2t.net/addgene:115668 ; RRID:Addgene_115668)
  • For your References section:

    Mesoscopic to Macroscopic Electron Transfer by Hopping in a Crystal Network of Cytochromes. Huang J, Zarzycki J, Gunner MR, Parson WW, Kern JF, Yano J, Ducat DC, Kramer DM. J Am Chem Soc. 2020 Jun 10;142(23):10459-10467. doi: 10.1021/jacs.0c02729. Epub 2020 May 29. 10.1021/jacs.0c02729 PubMed 32406683
Commonly requested with: