PB-CAG-GFPd2
(Plasmid #115665)

• Purpose: Piggybac transposon plasmid for destabilized eGFP (GFPd2)
• Depositing Lab: Jordan Green
• Publication: Rui et al ACS Appl Mater Interfaces. 2019 Feb 22. doi: 10.1021/acsami.8b20206.

Backbone

• Vector backbone: pCAG-GFP
• Backbone size w/o insert (bp): 5551
• Total vector size (bp): 6466
• Modifications to backbone: Insertion of piggybac inverted terminal repeats and destabilization domain to eGFP
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFPd2
• Alt name: Destabilized eGFP
• Species: Synthetic
• Insert Size (bp): 843
• Promoter: CAG
• Tag / Fusion Protein:
  • Destabilization (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CAGGGTTATTGTCTCATGAGCGGA
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGG

Resource Information

• Supplemental Documents:
  • pb-cag-gfpd2.gb
• A portion of this plasmid was derived from a plasmid made by: Cloned GFPd2 from Addgene plasmid 14760 and PBCAG-GFP backbone from Addgene plasmid 40973
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Co-transfection with super piggybac transposase leads to stable integration in mammalian chromosomal DNA.