pAav-TP53-T2A-BirA*
(Plasmid #115652)

• Purpose: rAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassette
• Depositing Lab: Sven Eyckerman
• Publication: Vandemoortele et al J Proteome Res. 2018 Dec 10. doi: 10.1021/acs.jproteome.8b00367.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAav
• Backbone manufacturer: Agilent technologies
• Backbone size w/o insert (bp): 2907
• Total vector size (bp): 7416
• Vector type: AAV
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TP53
• Species: H. sapiens (human)
• Insert Size (bp): 883
• Mutation: Homology region 1
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: NdeI (not destroyed)
• 5′ sequencing primer: CACTAGGGGTTCCTGCGGCCGCAAACGCGTCAGCCCTGCACAGACATTTT
• 3′ sequencing primer: TAGGGCGCGATAACTTCGTA

Gene/Insert 2

• Gene/Insert name: TP53
• Species: H. sapiens (human)
• Insert Size (bp): 838
• Mutation: Homology region 2
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGAGGATTGGGAAGACAAT
• 3′ sequencing primer: GGGTTCCTGCGGCCGCTTTTGCTAGCAGATCACGCCACTCCACTCC

Gene/Insert 3

• Gene/Insert name: T2A
• Species: Synthetic
• Insert Size (bp): 63
• Tag / Fusion Protein:
  • T2A

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: CACTAGGGGTTCCTGCGGCCGCAAACGCGTCAGCCCTGCACAGACATTTT
• 3′ sequencing primer: TAGGGCGCGATAACTTCGTA

Gene/Insert 4

• Gene/Insert name: BirA*
• Species: E. coli
• Tag / Fusion Protein:
  • BirA*

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ACATATTTGCATGGGGTGTG
• 3′ sequencing primer: TAGGGCGCGATAACTTCGTA

Resource Information

• Supplemental Documents:
  • pAav-TP53-T2A-BirA_ donor template.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/427807v2 for bioRxiv preprint.