Skip to main content
Addgene

AAVS1-TRE3G-NODALvar-matMYC
(Plasmid #115641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115641 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAVS1-TRE3G
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can be grown at 37°C in TOP10 E. coli.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NODAL splice variant
  • Species
    H. sapiens (human)
  • Entrez Gene
    NODAL (a.k.a. HTX5)
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer TRE3G (GATCGCCTGGAGCAATTCCAC)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use with TALENs #52341 and #52342. Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TRE3G-NODALvar-matMYC was a gift from Lynne Postovit (Addgene plasmid # 115641 ; http://n2t.net/addgene:115641 ; RRID:Addgene_115641)
  • For your References section:

    Genetically regulated human NODAL splice variants are differentially post-transcriptionally processed and functionally distinct. Findlay SD, Bilyk O, Lypka K, Waskiewicz AJ, Postovit L. (2018) bioRxiv 276170 10.1101/276170