pTaU6-esgRNA
(Plasmid
#115630)
-
Purposeexpression esgRNA in wheat protoplasts
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC58
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTaU6p-esgRNA
-
gRNA/shRNA sequencegtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTaU6-esgRNA was a gift from Caixia Gao (Addgene plasmid # 115630 ; http://n2t.net/addgene:115630 ; RRID:Addgene_115630) -
For your References section:
Expanded base editing in rice and wheat using a Cas9-adenosine deaminase fusion. Li C, Zong Y, Wang Y, Jin S, Zhang D, Song Q, Zhang R, Gao C. Genome Biol. 2018 May 29;19(1):59. doi: 10.1186/s13059-018-1443-z. 10.1186/s13059-018-1443-z PubMed 29807545