Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-X2DM
(Plasmid #115571)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115571 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS406-ADH1/CYC1
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7500
  • Modifications to backbone
    Inserted multiple cloning site of pRS316
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Green Fluorescent Protein
  • Alt name
    GFP
  • Species
    Synthetic
  • Insert Size (bp)
    753
  • Mutation
    Two repeats of the Gcn5 consensus motif are tagged to C-term of GFP, Both sites mutated to Arginine
  • Promoter ADH1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATGAGCAACGGTATACGG
  • 3′ sequencing primer AATGTTACATGCGTACACGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/345637v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-X2DM was a gift from Michael Downey (Addgene plasmid # 115571 ; http://n2t.net/addgene:115571 ; RRID:Addgene_115571)
  • For your References section:

    A synthetic non-histone substrate to study substrate targeting by the Gcn5 HAT and sirtuin HDACs. Rossl A, Denoncourt A, Lin MS, Downey M. J Biol Chem. 2019 Apr 19;294(16):6227-6239. doi: 10.1074/jbc.RA118.006051. Epub 2019 Feb 25. 10.1074/jbc.RA118.006051 PubMed 30804216