-
PurposeRed fluorescent voltage indicator for neuronal expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-Synapsin
- Backbone size w/o insert (bp) 4640
- Total vector size (bp) 6023
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameVARNAM
-
SpeciesSynthetic
-
Insert Size (bp)1383
- Promoter human Synapsin
-
Tag
/ Fusion Protein
- Golgi and ER export signal (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
- 3′ sequencing primer GGCCACAACTCCTCATAAAGAGACAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-VARNAM was a gift from Vincent Pieribone (Addgene plasmid # 115554 ; http://n2t.net/addgene:115554 ; RRID:Addgene_115554) -
For your References section:
Fast, in vivo voltage imaging using a red fluorescent indicator. Kannan M, Vasan G, Huang C, Haziza S, Li JZ, Inan H, Schnitzer MJ, Pieribone VA. Nat Methods. 2018 Dec;15(12):1108-1116. doi: 10.1038/s41592-018-0188-7. Epub 2018 Nov 12. 10.1038/s41592-018-0188-7 PubMed 30420685