Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FUW-TetON-GFP
(Plasmid #115495)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115495 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW TetON (AddGene plasmid etO-FUW-OSKM Plasmid #20321)
  • Backbone manufacturer
    Whitehead Institute
  • Backbone size w/o insert (bp) 8400
  • Total vector size (bp) 9102
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Alt name
    GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaaagtcgagctcggtaccc
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-TetON-GFP was a gift from Catherine Verfaillie (Addgene plasmid # 115495 ; http://n2t.net/addgene:115495 ; RRID:Addgene_115495)
  • For your References section:

    SOX10 Single Transcription Factor-Based Fast and Efficient Generation of Oligodendrocytes from Human Pluripotent Stem Cells. Garcia-Leon JA, Kumar M, Boon R, Chau D, One J, Wolfs E, Eggermont K, Berckmans P, Gunhanlar N, de Vrij F, Lendemeijer B, Pavie B, Corthout N, Kushner SA, Davila JC, Lambrichts I, Hu WS, Verfaillie CM. Stem Cell Reports. 2018 Feb 13;10(2):655-672. doi: 10.1016/j.stemcr.2017.12.014. Epub 2018 Jan 11. 10.1016/j.stemcr.2017.12.014 PubMed 29337119