Skip to main content
Addgene

pPBbsr-JNK KTR-mCherry
(Plasmid #115493)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115493 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pPB
  • Backbone manufacturer
    Allan Bradley (Wellcome Sanger Institute)
  • Backbone size w/o insert (bp) 6777
  • Total vector size (bp) 7668
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JNK KTR-mCherry
  • Alt name
    JNK Kinase Translocation Reporter
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    891
  • Mutation
    mCherry G229L, mCherry Y298 deleted
  • GenBank ID
  • Promoter CAG
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer gggccctcacattgccaaa
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Markus Covert (Stanford University)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See also: Regot et al Cell. 2014 Jun 19;157(7):1724-34. doi: 10.1016/j.cell.2014.04.039.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPBbsr-JNK KTR-mCherry was a gift from Kazuhiro Aoki (Addgene plasmid # 115493 ; http://n2t.net/addgene:115493 ; RRID:Addgene_115493)

  • For your References section:

    Cell-to-Cell Heterogeneity in p38-Mediated Cross-Inhibition of JNK Causes Stochastic Cell Death. Miura H, Kondo Y, Matsuda M, Aoki K. Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020. 10.1016/j.celrep.2018.08.020 PubMed 30184500
Related items:
Commonly requested with: