pLKO.1-shCELF4-4404
(Plasmid
#115465)
-
PurposeConstitutive lentiviral expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerBroad Institute - Genetic Perturbation Platform
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshCELF4-4404
-
gRNA/shRNA sequenceCTGCTGCCTATGGTCAGATAA
-
SpeciesH. sapiens (human)
-
Entrez GeneCELF4 (a.k.a. BRUNOL-4, BRUNOL4)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-shCELF4-4404 was a gift from William Hahn (Addgene plasmid # 115465 ; http://n2t.net/addgene:115465 ; RRID:Addgene_115465) -
For your References section:
An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer. Li J, Choi PS, Chaffer CL, Labella K, Hwang JH, Giacomelli AO, Kim JW, Ilic N, Doench JG, Ly SH, Dai C, Hagel K, Hong AL, Gjoerup O, Goel S, Ge JY, Root DE, Zhao JJ, Brooks AN, Weinberg RA, Hahn WC. Elife. 2018 Jul 30;7. pii: 37184. doi: 10.7554/eLife.37184. 37184 [pii] PubMed 30059005