Skip to main content
Addgene

pXPR_BRD003-sgQKI-2201
(Plasmid #115449)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115449 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pXPR_BRD003
  • Backbone manufacturer
    Broad Institute - Genetic Perturbation Platform
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgQKI-2201
  • gRNA/shRNA sequence
    GGATGTAAAATCATGGTCCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    QKI (a.k.a. Hqk, QK, QK1, QK3, hqkI)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD003-sgQKI-2201 was a gift from William Hahn (Addgene plasmid # 115449 ; http://n2t.net/addgene:115449 ; RRID:Addgene_115449)

  • For your References section:

    An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer. Li J, Choi PS, Chaffer CL, Labella K, Hwang JH, Giacomelli AO, Kim JW, Ilic N, Doench JG, Ly SH, Dai C, Hagel K, Hong AL, Gjoerup O, Goel S, Ge JY, Root DE, Zhao JJ, Brooks AN, Weinberg RA, Hahn WC. Elife. 2018 Jul 30;7. pii: 37184. doi: 10.7554/eLife.37184. 37184 [pii] PubMed 30059005

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More
Related items:
Commonly requested with: