YIplac211-Erg11-iGFPx3
(Plasmid #115422)

• Purpose: Express Erg11-iGFPx3 at the endogenous locus via pop-in pop-out mutagenesis
• Depositing Lab: Benjamin Glick
• Publication: Casler et al J Cell Biol. 2019 May 6;218(5):1582-1601. doi: 10.1083/jcb.201807195. Epub 2019 Mar 11.

Backbone

• Vector backbone: YIplac211
• Total vector size (bp): 7211
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Erg11-iGFPx3
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 3500
• Promoter: Endogenous
• Tag / Fusion Protein:
  • iGFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: SphI (unknown if destroyed)
• 5′ sequencing primer: GTAAAACGACGGCCAGT
• 3′ sequencing primer: CACACAGGAAACAGCTATGACCAT

Resource Information

• Supplemental Documents:
  • Snapgene file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry