pHM6g.TM1457
(Plasmid #11540)

• Depositing Lab: Sung-Hou Kim
• Publication: Shin et al J Struct Biol. 2005 Nov . 152(2):113-7.

Backbone

• Vector backbone: pHM6g
• Backbone size w/o insert (bp): 6520
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TM1457
• Species: T. maritima
• Insert Size (bp): 282
• GenBank ID: AAD36525 TM1457 NP_229256
• Entrez Gene: TM1457
• Tag / Fusion Protein:
  • HisTag-MBP, TEV cleavable (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGTCAGACTGTCGATGAAGCCC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the plasmid pHM6g.TM1457 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244