pTH862-CEN-slowmaxRLuc/minCFLuc
(Plasmid #115371)

• Purpose: Expresses translation initiation-controlled Renilla luciferase and translation elongation-controlled firefly luciferase
• Depositing Lab: Tobias von der Haar
• Publication: Elongation controlled transcripts in yeast (unpublished)

Backbone

• Vector backbone: pTH644
• Backbone size w/o insert (bp): 6615
• Total vector size (bp): 9691
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Firefly Luciferase (codon minimised)
• Alt name: CFLuc
• Species: Synthetic; Photinus pyralis
• Insert Size (bp): 1664
• Mutation: All codons have been exchanged for the least favourable codons for yeast expression. The last three codons of the full-length Firefly luciferase gene have been deleted to yield a luciferase variant which is fully functional, but no longer localises to peroxisomes.
• GenBank ID: AF043450
• Promoter: TDH3

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GTATATAAAGAACGGTAGG

Gene/Insert 2

• Gene/Insert name: Gcn4 5'-UTR + Renilla luciferase (codon optimised)
• Alt name: RLuc
• Species: Synthetic; Renilla reniformis
• Insert Size (bp): 1446
• Mutation: All codons have been changed for the most favourable codons for yeast expression.
• GenBank ID: AF043450.1
• Promoter: ADH1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTGCAATTATTAATCTTTTGTTTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry