Skip to main content
Addgene

p CIneo-RL-Let7-perf
(Plasmid #115367)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115367 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCIneo
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5472
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Renilla Luciferase
  • Alt name
    Let7 perfect binding site :ACTATACAACCTACTACCTCA
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer T3
  • 3′ sequencing primer T7
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

clone number 138

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p CIneo-RL-Let7-perf was a gift from Witold Filipowicz & Ramesh Pillai (Addgene plasmid # 115367 ; http://n2t.net/addgene:115367 ; RRID:Addgene_115367)

  • For your References section:

    Inhibition of translational initiation by Let-7 MicroRNA in human cells. Pillai RS, Bhattacharyya SN, Artus CG, Zoller T, Cougot N, Basyuk E, Bertrand E, Filipowicz W. Science. 2005 Sep 2. 309(5740):1573-6. 10.1126/science.1115079 PubMed 16081698
Related items:
Commonly requested with: