Skip to main content
Addgene

pLIC.B2.MPN330
(Plasmid #11536)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11536 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLIC.B2
  • Backbone size w/o insert (bp) 6143
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FAD synthetase
  • Species
    T. maritima
  • Insert Size (bp)
    882
  • GenBank ID
    AAB96154 MPN330 NP_110018
  • Tag / Fusion Protein
    • HisTag, non-cleavable (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pLIC.B2.MPN330 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIC.B2.MPN330 was a gift from Sung-Hou Kim (Addgene plasmid # 11536 ; http://n2t.net/addgene:11536 ; RRID:Addgene_11536)

  • For your References section:

    A model for the determination of the 3D-spatial distribution of the functions of the hormone-binding domain of receptors that bind 3-keto-4-ene steroids. Lemesle-Varloot L, Ojasoo T, Mornon JP, Raynaud JP. J Steroid Biochem Mol Biol. 1992 Mar . 41(3-8):369-88. 10.1016/0960-0760(92)90363-N PubMed 1562512
Related items: