pCA528 CHMP1B 4-199
(Plasmid
#115325)
-
PurposeExpresses residues 4-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-23
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCA528
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCHMP1B
-
Alt nameCharged multivesicular body protein 1b
-
SpeciesH. sapiens (human)
-
Entrez GeneCHMP1B (a.k.a. C10orf2, C18-ORF2, C18orf2, CHMP1.5, Vps46-2, Vps46B, hVps46-2)
-
Tag
/ Fusion Protein
- His-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATGGAAGCGTTCGCTAAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCA528 CHMP1B 4-199 was a gift from Wesley Sundquist (Addgene plasmid # 115325 ; http://n2t.net/addgene:115325 ; RRID:Addgene_115325) -
For your References section:
Membrane constriction and thinning by sequential ESCRT-III polymerization. Nguyen HC, Talledge N, McCullough J, Sharma A, Moss FR 3rd, Iwasa JH, Vershinin MD, Sundquist WI, Frost A. Nat Struct Mol Biol. 2020 Apr;27(4):392-399. doi: 10.1038/s41594-020-0404-x. Epub 2020 Apr 6. 10.1038/s41594-020-0404-x PubMed 32251413