Skip to main content
Addgene

pLIC.B4.TM1717
(Plasmid #11532)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11532 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLIC.B4
  • Backbone size w/o insert (bp) 7313
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YjeQ GDP binding protein
  • Alt name
    GTPase
  • Species
    T. maritima
  • Insert Size (bp)
    885
  • GenBank ID
    AAD36783 TM1717 NP_229516
  • Entrez Gene
    TM1717
  • Tag / Fusion Protein
    • HisTag-MBP, TEV cleavable (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer CGTCAGACTGTCGATGAAGCCC
  • 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pLIC.B4.TM1717 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIC.B4.TM1717 was a gift from Sung-Hou Kim (Addgene plasmid # 11532 ; http://n2t.net/addgene:11532 ; RRID:Addgene_11532)

  • For your References section:

    Crystal structure of YjeQ from Thermotoga maritima contains a circularly permuted GTPase domain. Shin DH, Lou Y, Jancarik J, Yokota H, Kim R, Kim SH. Proc Natl Acad Sci U S A. 2004 Sep 7. 101(36):13198-203. 10.1073/pnas.0405202101 PubMed 15331784
Related items: