pLD-puro-Cc-CR-PARK7WT-VA
(Plasmid
#115187)
-
PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115187 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLD-Cc-puro-VA
-
Backbone manufacturerJason Moffat, Addgene plasmid # 24588
- Backbone size w/o insert (bp) 7737
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCR (CRISPR/Cas9-resistant)-PARK7WT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)567
-
Mutationc.150G>A (silent when translated to protein, confers CRISPR/Cas9 resistance since it mutates the canonical PAM site)
-
Entrez GenePARK7 (a.k.a. DJ-1, DJ1, GATD2, HEL-S-67p)
- Promoter CMV
-
Tag
/ Fusion Protein
- Versatile affinity tag (2XStreptactin II-6XHis-3XFlag) (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV_F
- 3′ sequencing primer hPGK_R [5'-ccttggaaaaggcgcaacc-3'] (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLD-puro-Cc-CR-PARK7WT-VA was a gift from Mohan Babu (Addgene plasmid # 115187 ; http://n2t.net/addgene:115187 ; RRID:Addgene_115187) -
For your References section:
Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960