RCASBP-Y CHA
(Plasmid #11480)

• Depositing Lab: William Pavan
• Publication: Loftus et al DNA Res. 2001 Oct 31. 8(5):221-6.

Backbone

• Vector backbone: RCASBP-Y
• Backbone size w/o insert (bp): 11600
• Vector type: Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: Db3.1 cells due to presence of ccdB gene
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Gateway ccdB reading frame cassette
• Insert Size (bp): 2200
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NOT1 (unknown if destroyed)
• 3′ cloning site: Swa1 (not destroyed)
• 5′ sequencing primer: gagctgagctgactctgctggtggc
• 3′ sequencing primer: cagatacgcgtatatctggc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry