RCASBP-Y NHA
(Plasmid
#11479)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneRCASBP-Y
- Backbone size w/o insert (bp) 11600
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsDb3.1 cells due to presence of ccdB gene
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGateway ccdB reading frame cassette
-
Insert Size (bp)2200
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NOT1 (unknown if destroyed)
- 3′ cloning site Swa1 (not destroyed)
- 5′ sequencing primer gagctgagctgactctgctggtggc
- 3′ sequencing primer cagatacgcgtatatctggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCASBP-Y NHA was a gift from William Pavan (Addgene plasmid # 11479 ; http://n2t.net/addgene:11479 ; RRID:Addgene_11479) -
For your References section:
Generation of RCAS vectors useful for functional genomic analyses. Loftus SK, Larson DM, Watkins-Chow D, Church DM, Pavan WJ. DNA Res. 2001 Oct 31. 8(5):221-6. 10.1093/dnares/8.5.221 PubMed 11759842