Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RCASBP-Y NHA
(Plasmid #11479)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11479 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    RCASBP-Y
  • Backbone size w/o insert (bp) 11600
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    Db3.1 cells due to presence of ccdB gene
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gateway ccdB reading frame cassette
  • Insert Size (bp)
    2200
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NOT1 (unknown if destroyed)
  • 3′ cloning site Swa1 (not destroyed)
  • 5′ sequencing primer gagctgagctgactctgctggtggc
  • 3′ sequencing primer cagatacgcgtatatctggc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCASBP-Y NHA was a gift from William Pavan (Addgene plasmid # 11479 ; http://n2t.net/addgene:11479 ; RRID:Addgene_11479)
  • For your References section:

    Generation of RCAS vectors useful for functional genomic analyses. Loftus SK, Larson DM, Watkins-Chow D, Church DM, Pavan WJ. DNA Res. 2001 Oct 31. 8(5):221-6. 10.1093/dnares/8.5.221 PubMed 11759842