AKARet-PSD
(Plasmid #114732)

• Purpose: PSD-targeted AKARet
• Depositing Lab: Ryohei Yasuda
• Publication: Tang et al Neuron. 2017 Mar 22;93(6):1315-1324.e3. doi: 10.1016/j.neuron.2017.02.032. Epub 2017 Mar 9.

Backbone

• Vector backbone: pCI
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PSD-targeted AKARet
• Insert Size (bp): 3300
• Promoter: CMV
• Tags / Fusion Proteins:
  • N-terminus of PSD-95 (N terminal on insert)
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KasI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: CCCTGAACCTGAAACATAAAATG

Resource Information

• Supplemental Documents:
  • Annotated Sequence
• A portion of this plasmid was derived from a plasmid made by: Our lab (EKAR), Michiyuki Matsuda (AKAR3EV)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry