pGALSc104(A509D)
(Plasmid
#1147)
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 1147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLA1 (pRS313:GAL1-10)
- Backbone size w/o insert (bp) 5703
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSP104
-
Alt name5719
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2850
-
MutationA509D
-
GenBank IDM67479
-
Entrez GeneHSP104 (a.k.a. YLL026W)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer TACCTCTATACTTTAACGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGALSc104(A509D) was a gift from Susan Lindquist (Addgene plasmid # 1147 ; http://n2t.net/addgene:1147 ; RRID:Addgene_1147) -
For your References section:
Dominant gain-of-function mutations in Hsp104p reveal crucial roles for the middle region. Schirmer EC, Homann OR, Kowal AS, Lindquist S. Mol Biol Cell 2004 May;15(5):2061-72. Epub 2004 Feb 20. 10.1091/mbc.e02-08-0502 PubMed 14978213