mOtop1_pGEMHE
(Plasmid #114674)

• Purpose: This construct was used to express mouse Otop1 in Xenopus laevis oocytes
• Depositing Lab: Emily Liman
• Publication: Tu et al Science. 2018 Mar 2;359(6379):1047-1050. doi: 10.1126/science.aao3264. Epub 2018 Jan 25.

Backbone

• Vector backbone: pGEMHE
• Backbone size w/o insert (bp): 3019
• Total vector size (bp): 4822
• Vector type: For generating the mRNA, which can highly express in Xenopus laevis oocytes

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Otopetrin 1
• Alt name: Otop1
• Species: M. musculus (mouse)
• Insert Size (bp): 1803
• Mutation: SNP (rs49325632): Glycine 396 to Alanine
• GenBank ID: NM_172709
• Entrez Gene: Otop1 (a.k.a. A530025J20Rik, Otp1, tlt)
• Promoter: T7

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: TTAGGAGCAGATACGAATGGCTAC

Resource Information

• Supplemental Documents:
  • mOtop1_pGEMHE.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry