pTriEX Tom20 mVenus BoLD
(Plasmid
#114468)
-
PurposeMammalian expression of mitochondrially targeted, mVenus labelled BoLD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTriEX
- Backbone size w/o insert (bp) 5886
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBoLD
-
SpeciesSynthetic
-
Insert Size (bp)168
- Promoter CMV
-
Tags
/ Fusion Proteins
- TOM20 and mVenus (N terminal on insert)
- HIS, TEV and FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEX Tom20 mVenus BoLD was a gift from Andrew Woolley (Addgene plasmid # 114468 ; http://n2t.net/addgene:114468 ; RRID:Addgene_114468) -
For your References section:
Discovering Selective Binders for Photoswitchable Proteins Using Phage Display. Reis JM, Xu X, McDonald S, Woloschuk RM, Jaikaran ASI, Vizeacoumar FS, Woolley GA, Uppalapati M. ACS Synth Biol. 2018 Oct 19;7(10):2355-2364. doi: 10.1021/acssynbio.8b00123. Epub 2018 Sep 27. 10.1021/acssynbio.8b00123 PubMed 30203962