Skip to main content
Addgene

pIAGO-Hap2
(Plasmid #114460)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114460 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pIAGO
  • Vector type
    Bacterial Expression
  • Selectable markers
    Thiostrepton for streptomycete hosts

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hap2 + perDII
  • Promoter ermE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer 5_ ATGCGAGTGTCCGTTCGAGTG 3_
  • 3′ sequencing primer 5_ GTTAGCTCACTCATTAGGCAC 3_
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes an AmphDI-PerDI hybrid glycosyltransferase and a PerDII perosamine synthase.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIAGO-Hap2 was a gift from Patrick Caffrey (Addgene plasmid # 114460 ; http://n2t.net/addgene:114460 ; RRID:Addgene_114460)

  • For your References section:

    Redesign of polyene macrolide glycosylation: engineered biosynthesis of 19-(O)-perosaminyl-amphoteronolide B. Hutchinson E, Murphy B, Dunne T, Breen C, Rawlings B, Caffrey P. Chem Biol. 2010 Feb 26;17(2):174-82. doi: 10.1016/j.chembiol.2010.01.007. 10.1016/j.chembiol.2010.01.007 PubMed 20189107
Related items: