pIAGO-Hap2
(Plasmid #114460)

• Purpose: Expression of hybrid AmphDI-PerDI (Hap) glycosyltansferase and perosamine synthase in streptomycetes
• Depositing Lab: Patrick Caffrey
• Publication: Hutchinson et al Chem Biol. 2010 Feb 26;17(2):174-82. doi: 10.1016/j.chembiol.2010.01.007.

Backbone

• Vector backbone: pIAGO
• Vector type: Bacterial Expression
• Selectable markers: Thiostrepton for streptomycete hosts

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hap2 + perDII
• Promoter: ermE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: 5_ ATGCGAGTGTCCGTTCGAGTG 3_
• 3′ sequencing primer: 5_ GTTAGCTCACTCATTAGGCAC 3_

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes an AmphDI-PerDI hybrid glycosyltransferase and a PerDII perosamine synthase.