Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIAGO-pegA + aceS
(Plasmid #114457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIAGO
  • Vector type
    Bacterial Expression
  • Selectable markers
    Thiostrepton for streptomycete hosts

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pegA + aceS
  • Promoter ermE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer 5_ ATGCGAGTGTCCGTTCGAGTG 3_
  • 3′ sequencing primer 5_ GTTAGCTCACTCATTAGGCAC 3_
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A HindIII fragment containing the aceS gene was inerted into the HindIII site of plasmid pIAGO-pegAI. The glycosyltransferase and methylase genes are in the same orientation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIAGO-pegA + aceS was a gift from Patrick Caffrey (Addgene plasmid # 114457 ; http://n2t.net/addgene:114457 ; RRID:Addgene_114457)
  • For your References section:

    New insights into polyene macrolide biosynthesis in Couchioplanes caeruleus. Sheehan J, Murphy CD, Caffrey P. Mol Biosyst. 2017 May 2;13(5):866-873. doi: 10.1039/c7mb00112f. 10.1039/c7mb00112f PubMed 28383583