-
PurposeYeast Integration Plasmid for galactose inducible Ec86-RT and SpCas9 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS403
-
Vector typeYeast Expression, CRISPR
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9, Ec86-RT
-
SpeciesS. pyogenes, E. coli
-
MutationS. cerevisiae codon optimized
- Promoter GAL1-GAL10
-
Tag
/ Fusion Protein
- SV40-NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAATTAACCCTCACTAAAGG
- 3′ sequencing primer taatacgactcactatagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made bySpCas9 from Addgene 43802
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZS157 CRISPEY RT/Cas9 was a gift from Hunter Fraser (Addgene plasmid # 114454 ; http://n2t.net/addgene:114454 ; RRID:Addgene_114454) -
For your References section:
Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing. Sharon E, Chen SA, Khosla NM, Smith JD, Pritchard JK, Fraser HB. Cell. 2018 Sep 18. pii: S0092-8674(18)31118-8. doi: 10.1016/j.cell.2018.08.057. 10.1016/j.cell.2018.08.057 PubMed 30245013