Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZS157 CRISPEY RT/Cas9
(Plasmid #114454)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114454 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS403
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9, Ec86-RT
  • Species
    S. pyogenes, E. coli
  • Mutation
    S. cerevisiae codon optimized
  • Promoter GAL1-GAL10
  • Tag / Fusion Protein
    • SV40-NLS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAATTAACCCTCACTAAAGG
  • 3′ sequencing primer taatacgactcactatagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZS157 CRISPEY RT/Cas9 was a gift from Hunter Fraser (Addgene plasmid # 114454 ; http://n2t.net/addgene:114454 ; RRID:Addgene_114454)
  • For your References section:

    Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing. Sharon E, Chen SA, Khosla NM, Smith JD, Pritchard JK, Fraser HB. Cell. 2018 Sep 18. pii: S0092-8674(18)31118-8. doi: 10.1016/j.cell.2018.08.057. 10.1016/j.cell.2018.08.057 PubMed 30245013