Skip to main content
Addgene

pLKO.TRC1.shmNsd1.1, puro
(Plasmid #114446)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114446 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO TRC1
  • Backbone manufacturer
    Sigma aldrich
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shNsd1.1
  • gRNA/shRNA sequence
    GCTCGTTAAGACACCAGGAAA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nsd1 (a.k.a. AI528500, KMT3B)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.TRC1.shmNsd1.1, puro was a gift from Adrian Bracken (Addgene plasmid # 114446 ; http://n2t.net/addgene:114446 ; RRID:Addgene_114446)

  • For your References section:

    The H3K36me2 Methyltransferase Nsd1 Demarcates PRC2-Mediated H3K27me2 and H3K27me3 Domains in Embryonic Stem Cells. Streubel G, Watson A, Jammula SG, Scelfo A, Fitzpatrick DJ, Oliviero G, McCole R, Conway E, Glancy E, Negri GL, Dillon E, Wynne K, Pasini D, Krogan NJ, Bracken AP, Cagney G. Mol Cell. 2018 Apr 19;70(2):371-379.e5. doi: 10.1016/j.molcel.2018.02.027. Epub 2018 Mar 29. 10.1016/j.molcel.2018.02.027 PubMed 29606589
Related items:
Commonly requested with: