scADGFP
(Plasmid #114434)

• Purpose: Epilepsy promoter enhanced with Arc elements driving GFP with SV40E polyA
• Depositing Lab: Edward Perez-Reyes
• Publication: Burke et al Int J Mol Sci. 2023 Sep 23;24(19):14467. doi: 10.3390/ijms241914467.

Backbone

• Vector backbone: pLVUTH
• Backbone size w/o insert (bp): 4266
• Total vector size (bp): 6578
• Modifications to backbone: Lentiviral LTRs replaced with AAV ITRs and deletion of 5' CMV promoter
• Vector type: Mammalian Expression, AAV
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Green fluorescent protein
• Alt name: eGFP-ERX
• Species: Synthetic
• Insert Size (bp): 743
• Promoter: Novel synthetic activity-dependent promoter
• Tag / Fusion Protein:
  • ER export sequence FCYENEV (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AgeI (destroyed during cloning)
• 5′ sequencing primer: AAGGGCGACACGGAAATG
• 3′ sequencing primer: TCCGCCTCAGAAGCCATAGA

Resource Information

• Supplemental Documents:
  • scADGFP4.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry