Skip to main content
Addgene

Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
(Plasmid #114428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114428 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    TIGRE2.0 targeting vector
  • Backbone size w/o insert (bp) 15122
  • Total vector size (bp) 18023
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Alt name
    GCaMP6 fast
  • Insert Size (bp)
    1353
  • Promoter TRE2, CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlul... (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CTAATTCCATCAGAAAGCTT
  • 3′ sequencing primer CTGCCCGGCGGCTGTGAGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Loren Looger and Clontech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 114428 ; http://n2t.net/addgene:114428 ; RRID:Addgene_114428)
  • For your References section:

    A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Daigle TL, Madisen L, Hage TA, Valley MT, Knoblich U, Larsen RS, Takeno MM, Huang L, Gu H, Larsen R, Mills M, Bosma-Moody A, Siverts LA, Walker M, Graybuck LT, Yao Z, Fong O, Nguyen TN, Garren E, Lenz GH, Chavarha M, Pendergraft J, Harrington J, Hirokawa KE, Harris JA, Nicovich PR, McGraw MJ, Ollerenshaw DR, Smith KA, Baker CA, Ting JT, Sunkin SM, Lecoq J, Lin MZ, Boyden ES, Murphy GJ, da Costa NM, Waters J, Li L, Tasic B, Zeng H. Cell. 2018 Jul 12;174(2):465-480.e22. doi: 10.1016/j.cell.2018.06.035. 10.1016/j.cell.2018.06.035 PubMed 30007418