pLenti.puro.MCV.ER.RAZ.1
(Plasmid #114381)

• Purpose: This lentiviral plasmid expresses MCV tumor T antigens (truncated LT and small T) using the viral NCCR (non-coding control region). The sequence was amplifeied from MCV.R17a and truncated LT=330 aa.
• Depositing Labs: Reety Arora, Sudhir Krishna
• Publication: Lentiviral expression plasmid for MCV T antigens via MCV promoter (unpublished)

Backbone

• Vector backbone: pLentiCMVPuroDEST
• Backbone size w/o insert (bp): 9628
• Total vector size (bp): 9475
• Modifications to backbone: The backbone vector was cut using Cla1 and EcoRV, and then the PCR amplified Insert was cloned into these sites.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MCV NCCR and tumor T antigen regions
• Alt name: NCCR, ST, LT, truncLT
• Species: Merkel cell polyomavirus
• Insert Size (bp): 1887
• GenBank ID: HM011555.1 FJ173815.1
• Promoter: MCV NCCR (viral own promoter)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Cla1 (unknown if destroyed)
• 3′ cloning site: EcoRV (unknown if destroyed)
• 5′ sequencing primer: AAGAATAGTAGACATAATAG
• 3′ sequencing primer: GTGGATGTGGAATGTGTGCG

Resource Information

• Supplemental Documents:
  • Snapgene file for pLenti.puro.MCV.ER.RAZ.1
• A portion of this plasmid was derived from a plasmid made by: The MCV region was amplified from MCV.R17a strain by PCR using the addgene clone - #24729.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid was cloned by Anjali Vijaykumar and Reety Arora