Skip to main content
Addgene

pCAG-Tet-on Advanced -BGH-PA
(Plasmid #114379)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114379 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTet-On Advanced
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5255
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rtTA and BGH-pA
  • Insert Size (bp)
    2796
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site SacU (not destroyed)
  • 5′ sequencing primer ggagtgtatactggcttaactat
  • 3′ sequencing primer gggatatatcaacggtggtatat
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct is also called CAG-rtTA and has been used in our recent published paper ID 29386396.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Tet-on Advanced -BGH-PA was a gift from Yuet Wai Kan (Addgene plasmid # 114379 ; http://n2t.net/addgene:114379 ; RRID:Addgene_114379)

  • For your References section:

    Generation of induced pluripotent stem cells using site-specific integration with phage integrase. Ye L, Chang JC, Lin C, Qi Z, Yu J, Kan YW. Proc Natl Acad Sci U S A. 2010 Nov 9;107(45):19467-72. Epub 2010 Oct 25. 10.1073/pnas.1012677107 PubMed 20974949
Related items:
Commonly requested with: