pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
(Plasmid #114377)

• Purpose: expresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targeting
• Depositing Lab: Mingshan Xue
• Publication: Messier et al Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5625
• Total vector size (bp): 7497
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GtACR2-EYFP-Kv2.1C-linker-TlcnC
• Alt name: anion channelrhodopsin 2
• Insert Size (bp): 1872
• Entrez Gene: NEWENTRY
• Promoter: Ef1a
• Tags / Fusion Proteins:
  • EYFP (C terminal on insert)
  • Kv2.1C-linker-TlcnC (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: BamHI, NheI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC (Ef1a-F)
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA (WPRE-R)

Resource Information

• Supplemental Documents:
  • #203 pAAV-Ef1a-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC.gbk
• A portion of this plasmid was derived from a plasmid made by: Backbone vector from pAAV-EF1α-FRT-FLEX-GtACR2-EYFP (Addgene #114369)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/05/25/331165.1 for bioRxiv preprint.