Skip to main content
Addgene

pSKB3.MPN348
(Plasmid #11437)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11437 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSKB3
  • Backbone size w/o insert (bp) 5386
  • Modifications to backbone
    derivative of bacterial expression vector pET-28a with the thrombin protease site replaced by a TEV protease site
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    methenyltetrahydrofolate synthetase
  • Species
    Mycoplasma pneumoniae M129
  • Insert Size (bp)
    492
  • GenBank ID
    AAB96136 MPN348 NP_110036
  • Tags / Fusion Proteins
    • 6x His (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pSKB3.MPN348 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSKB3.MPN348 was a gift from Sung-Hou Kim (Addgene plasmid # 11437 ; http://n2t.net/addgene:11437 ; RRID:Addgene_11437)

  • For your References section:

    Crystal structure of methenyltetrahydrofolate synthetase from Mycoplasma pneumoniae (GI: 13508087) at 2.2 A resolution. Chen S, Shin DH, Pufan R, Kim R, Kim SH. Proteins. 2004 Sep 1. 56(4):839-43. 10.1002/prot.20214 PubMed 15281135
Related items: